To visit Exiqon, click here:

Tool description:

The SNPDesign tool generates optimal LNA spiked probes for SNP genotyping in a microtiter plate (MTP) based hybridization assay. The tool also designs the associated PCR primers where one of the primers is biotin labelled facilitating immobilization of the generated PCR amplicon into a streptavidin MTP well followed by hybridization of the designed LNA spiked probes (link til technote). Probes and PCR primers are generated based on input consisting of a target sequence, probe Tm and length constraints (see bottom of page for details on input/output formatting). The data output gives a set of probes and a set of PCR primers plus information on the generated probes. If the generated PCR primers for some reason are unsatisfactory the PCR primers can be designed by other means, provided that the length of the resulting PCR product falls within the range of 60-200 bp , and that the SNP site lies at least 15 bases from either end of the PCR product.

• Sequence data consists of the characters 'a', 't', 'c', 'g', 'A', 'T', 'C', 'G', '(', ')' and '/'. All other characters are filtered out before processing. (Be advised, that this includes characters 'u' and 'U'. Please use 't' instead.)
• Sequence data consists of a nucleotide sequence with exactly one SNP definition, inserted at the SNP position. The data can be split across multiple lines.
• A SNP definition must conform to the format '(*/*)' where * is either 'a', 't', 'c' or 'g'.
• Because the minimum PCR product size is set to 60, the sequence (after stripping!) must be at least 60 nucleotides in length.
• All output pertaining to the generated primers are reprinted verbatim from Primer3 output.
• An example of valid sequence data is:

          gaccccctccttccttctttccctaccgccccacgcgcgacccggggatg
          gctccgtggcctcacgagaacagctctcttgccccatggccggacctccc
          caccctggcgcccaataccgccaacaccagtgggctgccaggggttccgt
          gggaggcggccctagccggggccctgctggcgctggcggtgctggccacc
          (t/c)
          ggactccgagactccagaccatgaccaacgtgttcgtgacttcgctggcc
          gcagccgacctggtgatgggactcctggtggtgccgccggcggccacctt
          ggcgctgactggccactggccgttgggcgccactggctgcgagctgtgga
          cctcggtggacgtgctgtgtgtgaccgccagcatcgaaaccctgtgcgcc
          

• Within output sequences, LNA nucleotides are given as capitals, whereas input sequences are case insensitive.